I have a test program that gives different results when executing more than one goroutine on more than one Cpu (Goroutines = Cpus). The "test" is about syncing goroutines using channels, and the program itself counts occurences of chars in strings. It produces consistent results on one Cpu / one goroutine.
See code example on playground (Note: Run on local machine to execute on multi core, and watch the resulting numbers vary): http://play.golang.org/p/PT5jeCKgBv .
Code summary: The program counts occurences of 4 different chars (A,T, G,C) in (DNA) strings.
Problem: Result (n occurences of chars) varies when executed on multiple Cpu's (goroutines). Why?
Description:
Simplified code:
1. "Worker" (goroutines) counting chars in lines:
func Worker(inCh chan *[]byte, resA chan<- *int, resB chan<- *int, quit chan bool) {
//for p_ch := range inCh {
for {
p_ch, ok := <-inCh // similar to range
if ok {
ch := *p_ch
for i := 0; i < len(ch); i++ {
if ch[i] == 'A' || ch[i] == 'T' { // Count A:s and T:s
at++
} else if ch[i] == 'G' || ch[i] == 'C' { // Count G:s and C:s
gc++
}
}
resA <- &at // Send line results on separate channels
resB <- &gc // Send line results on separate channels
} else {
quit <- true // Indicate that we're all done
break
}
}
}
2. Spawn work (strings) to workers:
func SpawnWork(inStr chan<- *[]byte, quit chan bool) {
// Artificial input data
StringData :=
"NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
" +
"NTGAGAAATATGCTTTCTACTTTTTTGTTTAATTTGAACTTGAAAACAAAACACACACAA
" +
"... etc
" +
// ...
for scanner.Scan() {
s := scanner.Bytes()
if len(s) == 0 || s[0] == '>' {
continue
} else {
i++
inStr <- &s
}
}
close(inStr) // Indicate (to Workers) that there's no more strings coming.
}
3. Main routine:
func main() {
// Count Cpus, and count down in final select clause
CpuCnt := runtime.NumCPU()
runtime.GOMAXPROCS(CpuCnt)
// Make channels
resChA := make(chan *int)
resChB := make(chan *int)
quit := make(chan bool)
inStr := make(chan *[]byte)
// Set up Workers ( n = Cpu )
for i := 0; i < CpuCnt; i++ {
go Worker(inStr, resChA, resChB, quit)
}
// Send lines to Workers
go SpawnWork(inStr, quit)
// Count the number of "A","T" & "G","C" per line
// (comes in here as ints per row, on separate channels (at and gt))
for {
select {
case tmp_at := <-resChA:
tmp_gc := <-resChB // Ch A and B go in pairs anyway
A += *tmp_at // sum of A's and T's
B += *tmp_gc // sum of G's and C's
case <-quit:
// Each goroutine sends "quit" signals when it's done. Since
// the number of goroutines equals the Cpu counter, we count
// down each time a goroutine tells us it's done (quit at 0):
CpuCnt--
if CpuCnt == 0 { // When all goroutines are done then we're done.
goto out
}
}
}
out:
// Print report to screen
}
Why does this code count consistently only when executed on a singel cpu/goroutine? That is, the channels doesn't seem to sync, or the main loop quits forcefully before all goroutines are done? Scratching head.
(Again: See/run the full code at the playground: http://play.golang.org/p/PT5jeCKgBv )
// Rolf Lampa
Here is a working version which consistently produces the same results no matter how many cpus are used.
Here is what I did
*int
- very racy to pass in a channel!*[]byte
- pointless as slices are reference types anywayat
and gc
in Worker
- they were in the wrong place - this was the major cause of the difference in resultsI used the -race
parameter of go build to find and fix the data races.
package main
import (
"bufio"
"fmt"
"runtime"
"strings"
"sync"
)
func Worker(inCh chan []byte, resA chan<- int, resB chan<- int, wg *sync.WaitGroup) {
defer wg.Done()
fmt.Println("Worker started...")
for ch := range inCh {
at := 0
gc := 0
for i := 0; i < len(ch); i++ {
if ch[i] == 'A' || ch[i] == 'T' {
at++
} else if ch[i] == 'G' || ch[i] == 'C' {
gc++
}
}
resA <- at
resB <- gc
}
}
func SpawnWork(inStr chan<- []byte) {
fmt.Println("Spawning work:")
// An artificial input source.
StringData :=
"NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
" +
"NTGAGAAATATGCTTTCTACTTTTTTGTTTAATTTGAACTTGAAAACAAAACACACACAA
" +
"CTTCCCAATTGGATTAGACTATTAACATTTCAGAAAGGATGTAAGAAAGGACTAGAGAGA
" +
"TATACTTAATGTTTTTAGTTTTTTAAACTTTACAAACTTAATACTGTCATTCTGTTGTTC
" +
"AGTTAACATCCCTGAATCCTAAATTTCTTCAGATTCTAAAACAAAAAGTTCCAGATGATT
" +
"TTATATTACACTATTTACTTAATGGTACTTAAATCCTCATTNNNNNNNNCAGTACGGTTG
" +
"TTAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
" +
"NNNNNNNCTTCAGAAATAAGTATACTGCAATCTGATTCCGGGAAATATTTAGGTTCATAA
"
// Expand data n times
tmp := StringData
for n := 0; n < 1000; n++ {
StringData = StringData + tmp
}
scanner := bufio.NewScanner(strings.NewReader(StringData))
scanner.Split(bufio.ScanLines)
var i int
for scanner.Scan() {
s := scanner.Bytes()
if len(s) == 0 || s[0] == '>' {
continue
} else {
i++
s_copy := append([]byte(nil), s...)
inStr <- s_copy
}
}
close(inStr)
}
func main() {
CpuCnt := runtime.NumCPU() // Count down in select clause
CpuOut := CpuCnt // Save for print report
runtime.GOMAXPROCS(CpuCnt)
fmt.Printf("Processors: %d
", CpuCnt)
resChA := make(chan int)
resChB := make(chan int)
inStr := make(chan []byte)
fmt.Println("Spawning workers:")
var wg sync.WaitGroup
for i := 0; i < CpuCnt; i++ {
wg.Add(1)
go Worker(inStr, resChA, resChB, &wg)
}
fmt.Println("Spawning work:")
go func() {
SpawnWork(inStr)
wg.Wait()
close(resChA)
close(resChB)
}()
A := 0
B := 0
LineCnt := 0
for tmp_at := range resChA {
tmp_gc := <-resChB // Theese go together anyway
A += tmp_at
B += tmp_gc
LineCnt++
}
if !(A+B > 0) {
fmt.Println("No A/B was found!")
} else {
ABFraction := float32(B) / float32(A+B)
fmt.Println("
----------------------------")
fmt.Printf("Cpu's : %d
", CpuOut)
fmt.Printf("Lines : %d
", LineCnt)
fmt.Printf("A+B : %d
", A+B)
fmt.Printf("A : %d
", A)
fmt.Printf("B : %d
", A)
fmt.Printf("AB frac: %v
", ABFraction*100)
fmt.Println("----------------------------")
}
}